| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.075599 |
| Chromosome: | chromosome 8 |
| Location: | 3565528 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g375650 | CNS1 | (1 of 1) PTHR22904:SF389 - DNA POLYMERASE INTERACTING TPR CONTAINING PROTEIN OF 47KD; Cyclophilin seven suppressor 1 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCCCACTGCACCCACCTGCGGCCGAGTCA |
| Internal bar code: | TTGTATTGAGAAATTGGGTTAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 577 |
| LEAP-Seq percent confirming: | 84.5808 |
| LEAP-Seq n confirming: | 565 |
| LEAP-Seq n nonconfirming: | 103 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCTTTGGCGTGATTGGATT |
| Suggested primer 2: | GAGGCCGTGCAGTTCTACTC |