Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.075609 |
Chromosome: | chromosome 12 |
Location: | 5895627 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g533950 | COT1 | Cobalt transport protein; (1 of 1) PTHR33514//PTHR33514:SF3 - FAMILY NOT NAMED // PROTEIN ABCI12, CHLOROPLASTIC | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGAAGTAGTAGATGAGCACGCTGTAGGCA |
Internal bar code: | CGTACACGGCTCAGCGCGTGTT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 588 |
LEAP-Seq percent confirming: | 91.2482 |
LEAP-Seq n confirming: | 57480 |
LEAP-Seq n nonconfirming: | 5513 |
LEAP-Seq n unique pos: | 78 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGTTGAGTGGTTGTGTGG |
Suggested primer 2: | GGTAGGGTTGGTCTGGGAAT |