| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.075725 |
| Chromosome: | chromosome 4 |
| Location: | 1661932 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g213000 | MAE12 | (1 of 5) PTHR11206:SF94 - DNA-DAMAGE-INDUCIBLE PROTEIN F; MATE efflux family protein | intron|outside_mRNA |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCGTGAGTGGCGGTGGCAGTGGAGTGGCA |
| Internal bar code: | GAGGGCTGGGAAGCCGGATCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 466 |
| LEAP-Seq percent confirming: | 97.0454 |
| LEAP-Seq n confirming: | 17178 |
| LEAP-Seq n nonconfirming: | 523 |
| LEAP-Seq n unique pos: | 47 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTGCTATGTGGCGAGTGAAG |
| Suggested primer 2: | TCACAAGACAGGAAACACGC |