Insertion junction: LMJ.RY0402.075910_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.075910
Chromosome:chromosome_17
Location:1044160
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre17.g703600 OFD1 Basal body protein antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):GTTCATCAGCACACAGGCGTCGGACCCGCC
Internal bar code:GATGGTGCTTCACATAGCGGGT

Confirmation - LEAP-Seq

LEAP-Seq distance:535
LEAP-Seq percent confirming:97.7025
LEAP-Seq n confirming:3232
LEAP-Seq n nonconfirming:76
LEAP-Seq n unique pos:15

Suggested primers for confirmation by PCR

Suggested primer 1:TGTCCATCATCTCCTCCTCC
Suggested primer 2:CAGCAACTGCGTCTTGAGAG