| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.075923 |
| Chromosome: | chromosome 13 |
| Location: | 1796109 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g575000 | CCS1 | c-type cytochrome synthesis 1; (1 of 1) K07399 - cytochrome c biogenesis protein (resB, ccs1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTCGTGCGCGCCTAGCCTACTCTACAAG |
| Internal bar code: | GGCCCGTACACGCATGTCAGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 185 |
| LEAP-Seq percent confirming: | 35.9785 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 952 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAACCCTACTAATGCCGAA |
| Suggested primer 2: | ATCTCCAGTGAGTGCTGGCT |