| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.076084 |
| Chromosome: | chromosome 10 |
| Location: | 4030251 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449200 | ANK5 | (1 of 1) PTHR22849//PTHR24133//PTHR24133:SF23 - WDSAM1 PROTEIN // FAMILY NOT NAMED // SUBFAMILY NOT NAMED; Predicted protein with ankyrin repeats | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGATTGTCGGGGTGGCCCGAGGAGGCGCG |
| Internal bar code: | AAGCGCTCGCGCACAATCGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 413 |
| LEAP-Seq percent confirming: | 73.0263 |
| LEAP-Seq n confirming: | 111 |
| LEAP-Seq n nonconfirming: | 41 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGTGCCAGATGACACGC |
| Suggested primer 2: | CCACGCTGAAGACCTCCTAC |