| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.076106 |
| Chromosome: | chromosome 1 |
| Location: | 5111325 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g035500 | VPS34 | Vacuolar protein sorting 34; (1 of 1) 2.7.1.137 - Phosphatidylinositol 3-kinase / Type III phosphoinositide 3-kinase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCACCGCAAATGGTGAAACACACACCCC |
| Internal bar code: | TATTCAGCGTCAGTCACAATTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 84 |
| LEAP-Seq percent confirming: | 66.8306 |
| LEAP-Seq n confirming: | 1902 |
| LEAP-Seq n nonconfirming: | 944 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTGCAAGGAGATGATCGAG |
| Suggested primer 2: | CATCTTACGTCACCCGACCT |