Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.076227 |
Chromosome: | chromosome 6 |
Location: | 1194567 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g257550 | UCP2,UCP2A | (1 of 3) K15103 - solute carrier family 25 (mitochondrial uncoupling protein), member 8/9 (UCP2_3, SLC25A8_9); Mitochondrial uncoupling protein 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCCACGCTCGAGTCTTGCGTGTCCCCA |
Internal bar code: | CATGGACTATTGAAAGGTATCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 194 |
LEAP-Seq percent confirming: | 99.4039 |
LEAP-Seq n confirming: | 667 |
LEAP-Seq n nonconfirming: | 4 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGCTCTTCACCACAGTACGA |
Suggested primer 2: | CCCTTACCTCGCTGAGAGTG |