| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.076234 |
| Chromosome: | chromosome 1 |
| Location: | 3576176 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g023000 | PHT1,PHT4A,MFT12,PHT4-1 | Sodium-dependent phosphate transporter, major facilitator superfamily; (1 of 3) PTHR11662:SF223 - SODIUM-DEPENDENT PHOSPHATE TRANSPORT PROTEIN 1, CHLOROPLASTIC | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCAGGGACATGCCACCTGCAACGCCGACG |
| Internal bar code: | CGGAAGACGCCCCTTCGGGTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 752 |
| LEAP-Seq percent confirming: | 97.6157 |
| LEAP-Seq n confirming: | 1392 |
| LEAP-Seq n nonconfirming: | 34 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACGGACAGGTGCGTTTTATC |
| Suggested primer 2: | CATTTCTATGCAAGCGGGTT |