Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.076349 |
Chromosome: | chromosome 2 |
Location: | 5281224 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g106600 | RPS19 | Cytosolic 80S ribosomal protein S19; (1 of 1) K02966 - small subunit ribosomal protein S19e (RP-S19e, RPS19) | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTTCAGCGAGCGACTCGCCCCTTGCTCTT |
Internal bar code: | AAACCTTGGGTGACAAGCAAAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 671 |
LEAP-Seq percent confirming: | 98.3577 |
LEAP-Seq n confirming: | 6648 |
LEAP-Seq n nonconfirming: | 111 |
LEAP-Seq n unique pos: | 56 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTGTTTCAACTTGGCAAT |
Suggested primer 2: | CACCACTGCTCCTGTTCTGA |