| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.076421 |
| Chromosome: | chromosome 3 |
| Location: | 7194949 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g207950 | (1 of 1) K15216 - RNA polymerase I-specific transcription initiation factor RRN3 (RRN3, TIFIA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCAAACGCTCGTGTTGGGACAGCAGGAGC |
| Internal bar code: | TTGTTCTACGACCGCACGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 535 |
| LEAP-Seq percent confirming: | 98.7778 |
| LEAP-Seq n confirming: | 889 |
| LEAP-Seq n nonconfirming: | 11 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTAGTCCTGGCAGAAGGCTG |
| Suggested primer 2: | GACCATGTCCACTAGCGGTT |