| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.076586 |
| Chromosome: | chromosome 10 |
| Location: | 3644724 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g445650 | SMC3 | (1 of 1) K06669 - structural maintenance of chromosome 3 (chondroitin sulfate proteoglycan 6) (SMC3, CSPG6); Structural Maintenance of Chromosomes protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGTCAATGGGCACCGCTTTGGTGGGATT |
| Internal bar code: | CTGGGCCAGCCTGAACCTGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 566 |
| LEAP-Seq percent confirming: | 96.0069 |
| LEAP-Seq n confirming: | 1106 |
| LEAP-Seq n nonconfirming: | 46 |
| LEAP-Seq n unique pos: | 22 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGTTTGGCATTCCAGTGTC |
| Suggested primer 2: | ACCCTAGAGCGCACAAGAAA |