| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.076626 |
| Chromosome: | chromosome 3 |
| Location: | 1411952 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g151100 | SSA15 | cilia-sensing, structure and/or assembly; (1 of 2) PTHR22904//PTHR22904:SF312 - TPR REPEAT CONTAINING PROTEIN // CARBOXYLATE CLAMP-TETRATRICOPEPTIDE REPEAT PROTEIN | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTCACTACCGTTGAGCCTGCCAAACGCAA |
| Internal bar code: | CTTCCGTGAGGAGGATCCTTCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GACGTAGACACGCGATAGCA |
| Suggested primer 2: | TGTTGGCTGCATGTTGTGTA |