| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.076739 |
| Chromosome: | chromosome 17 |
| Location: | 1153267 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g704350 | GLOD4 | (1 of 1) PTHR10374//PTHR10374:SF20 - LACTOYLGLUTATHIONE LYASE GLYOXALASE I // GLYOXALASE DOMAIN-CONTAINING PROTEIN 4; Glyoxalase domain containing 4 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACATGGTCGAGATGCCGACCACATCCCACC |
| Internal bar code: | GTCGCACACAAGCCTAGTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 614 |
| LEAP-Seq percent confirming: | 89.7119 |
| LEAP-Seq n confirming: | 1962 |
| LEAP-Seq n nonconfirming: | 225 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCCCAAACTTAACCAAA |
| Suggested primer 2: | AAAAGACAGTGGGGTTGTGC |