Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.076770 |
Chromosome: | chromosome 3 |
Location: | 8792704 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g205809 | (1 of 1) PF01367//PF02739 - 5'-3' exonuclease, C-terminal SAM fold (5_3_exonuc) // 5'-3' exonuclease, N-terminal resolvase-like domain (5_3_exonuc_N) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTAGTCTTTGGGGTCCACACGCCCAGCAGG |
Internal bar code: | GGCAATCCGGGTCCCGCAGATT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 93 |
LEAP-Seq percent confirming: | 94.2623 |
LEAP-Seq n confirming: | 115 |
LEAP-Seq n nonconfirming: | 7 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAGGTTCCGGAAGTCAACAT |
Suggested primer 2: | CCTCCATCACCTACAGCGTT |