Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.076774 |
Chromosome: | chromosome_2 |
Location: | 881617 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre02.g079300 | VPS4 | AAA-ATPase of VPS4/SKD1 family | sense | 3'UTR |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | TATTCTGACGCAACGCTAAACGATAGGAAC |
Internal bar code: | TGAAACCATGCGCTAGTTGCAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 706 |
LEAP-Seq percent confirming: | 98.5997 |
LEAP-Seq n confirming: | 2394 |
LEAP-Seq n nonconfirming: | 34 |
LEAP-Seq n unique pos: | 27 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTGGCTAGGACTCACTG |
Suggested primer 2: | CTCTGGACTTGGAGGCTGAG |