Insertion junction: LMJ.RY0402.076774_3

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:+
Strain:LMJ.RY0402.076774
Chromosome:chromosome_2
Location:881617
Confidence (%):95
Locus disrupted Locus common name Defline Orientation Feature
Cre02.g079300 VPS4 AAA-ATPase of VPS4/SKD1 family sense 3'UTR

Insertion site details

Flanking sequence (orientation from cassette outwards):TCGAACGTATCAAGGGGTATCAATATAACT
Internal bar code:CCCCTCGACAGTATGTGGAACG

Confirmation - LEAP-Seq

LEAP-Seq distance:
LEAP-Seq percent confirming:
LEAP-Seq n confirming:0
LEAP-Seq n nonconfirming:0
LEAP-Seq n unique pos:0

Suggested primers for confirmation by PCR

Suggested primer 1:GGCTTGGCTAGGACTCACTG
Suggested primer 2:CTCTGGACTTGGAGGCTGAG