| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.076788 |
| Chromosome: | chromosome 7 |
| Location: | 645611 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317050 | UBQ6 | Ubiquitin; (1 of 2) IPR000626//IPR001841//IPR019956//IPR029071 - Ubiquitin domain // Zinc finger, RING-type // Ubiquitin // Ubiquitin-related domain | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCTGAGGCAAATGGCTTCAGCCGCTGAGCG |
| Internal bar code: | ATGGTAGTCAACCGTGCAAACG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 378 |
| LEAP-Seq percent confirming: | 98.366 |
| LEAP-Seq n confirming: | 602 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGATGAGGGCGTTGCTAGA |
| Suggested primer 2: | TTCAAGCGGCACTGTAACTG |