| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.076799 |
| Chromosome: | chromosome 7 |
| Location: | 103878 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g312900 | (1 of 1) K10590 - E3 ubiquitin-protein ligase TRIP12 (TRIP12) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTGTCCAGCGTGTCCCGCGTGCCTTGTG |
| Internal bar code: | GTCGACGAAGGAGGTAGTTGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 118 |
| LEAP-Seq percent confirming: | 25.5186 |
| LEAP-Seq n confirming: | 1267 |
| LEAP-Seq n nonconfirming: | 3698 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCGAGCGAGGTCAAAATTAG |
| Suggested primer 2: | CACCGCTGCTTATCAGTTCA |