Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.076874 |
Chromosome: | chromosome 9 |
Location: | 5134337 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g398882 | DLI1,D1bLIC | Dynein 1b Light Intermediate Chain D1bLIC; (1 of 1) K10417 - dynein light intermediate chain 2, cytosolic (DYNC2LI) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATGTGTTCGATGGCTCCAGTTGCGTCTCAG |
Internal bar code: | GTGGGAGAGTAGACGAAGGAG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 672 |
LEAP-Seq percent confirming: | 97.361 |
LEAP-Seq n confirming: | 5165 |
LEAP-Seq n nonconfirming: | 140 |
LEAP-Seq n unique pos: | 34 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGGAGCAGTACAAGGAGGAG |
Suggested primer 2: | GCACAGTAGTGGTGCCTTGA |