| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077050 |
| Chromosome: | chromosome 11 |
| Location: | 845353 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467649 | OPR107 | OctotricoPeptide Repeat protein 107; (1 of 1) IPR010622//IPR016024 - FAST kinase leucine-rich // Armadillo-type fold | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CAGGAGCTTCCTCCCGGTGTTCAATCCTTT |
| Internal bar code: | GGTATCAGCTCGAGAAGGTGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 314 |
| LEAP-Seq percent confirming: | 73.913 |
| LEAP-Seq n confirming: | 170 |
| LEAP-Seq n nonconfirming: | 60 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGACTCCAGTACGCTCC |
| Suggested primer 2: | GAAAGCATGCGTGACTTGAA |