| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.077114 |
| Chromosome: | chromosome 11 |
| Location: | 1013724 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467666 | LCI13,GT90F43,GT90-43 | Low-CO2-inducible 13; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGGACAGCCATGCGCAACATTTGCCAAC |
| Internal bar code: | TTTTACTTGAGTATGCGGTTTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 325 |
| LEAP-Seq percent confirming: | 67.8626 |
| LEAP-Seq n confirming: | 2232 |
| LEAP-Seq n nonconfirming: | 1057 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGAAGCTCCCAGTACCAGCA |
| Suggested primer 2: | GGGCTGGCTTGACATTAAAA |