Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.077213 |
Chromosome: | chromosome 12 |
Location: | 3517363 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g513150 | MIA40 | (1 of 1) K17046 - protein DEK (DEK) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGACACGGAGATGGCGGACGCGGACGAGAA |
Internal bar code: | ATACAGACTTTCGGGAAGGAGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 626 |
LEAP-Seq percent confirming: | 72.0 |
LEAP-Seq n confirming: | 630 |
LEAP-Seq n nonconfirming: | 245 |
LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTTTTTAATGCCGTGGTA |
Suggested primer 2: | GAAGAGGGCATTTGCTGAAG |