| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.077222 |
| Chromosome: | chromosome 7 |
| Location: | 3494734 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g335800 | PIH1D3,TWI1,DNAAF6,Twister | Twister-like Dynein assembly factor; (1 of 1) PTHR21083//PTHR21083:SF0 - TWISTER // PROTEIN PIH1D3 | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCTTGGCCCCAGAGCTTGACCTCGACGTC |
| Internal bar code: | TCCGATATTTGTTTTCACGCAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1135 |
| LEAP-Seq percent confirming: | 99.8124 |
| LEAP-Seq n confirming: | 1064 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACACACGTCGATGCTTTCTG |
| Suggested primer 2: | GGCTTGGCTAGGACTCACTG |