| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.077355 |
| Chromosome: | chromosome 2 |
| Location: | 292031 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g075150 | RPB2 | (1 of 1) K03010 - DNA-directed RNA polymerase II subunit RPB2 (RPB2, POLR2B); DNA-directed RNA polymerase II, 135 kDa polypeptide | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTGGTGGGGGTCGTTCGCCGGTGTGGCTC |
| Internal bar code: | TGCCTCTCGGAAACCCTTAGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 336 |
| LEAP-Seq percent confirming: | 93.3884 |
| LEAP-Seq n confirming: | 113 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCGTTGCTCCGAGTGTACTG |
| Suggested primer 2: | AGTCCATGTCTGCCCATTTC |