| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.077403 |
| Chromosome: | chromosome 2 |
| Location: | 3870262 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g095950 | (1 of 4) PF04640 - PLATZ transcription factor (PLATZ) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCCCGTACTCGTACGGACCCACCGCCA |
| Internal bar code: | GGTGAGGGCGCTCAGGAACTGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 55 |
| LEAP-Seq percent confirming: | 22.4622 |
| LEAP-Seq n confirming: | 104 |
| LEAP-Seq n nonconfirming: | 359 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGGCATGTACGACCAACACA |
| Suggested primer 2: | AGGTGTGGTTGGGATGTGTT |