| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.077432 |
| Chromosome: | chromosome 6 |
| Location: | 2762416 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g270900 | SUV3 | Mitochondrial DEAD-box DNA/RNA helicase; (1 of 1) K17675 - ATP-dependent RNA helicase SUPV3L1/SUV3 [EC:3.6.4.13] (SUPV3L1, SUV3) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGCCTCCCGCCCCGTGCGGCGCACCACCT |
| Internal bar code: | GTGCGGATGCACCACTCTCGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 821 |
| LEAP-Seq percent confirming: | 99.1826 |
| LEAP-Seq n confirming: | 364 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGGTCTGCGTGACTGGAAT |
| Suggested primer 2: | TGAGTCCTGGAAACCACACA |