Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.077448 |
Chromosome: | chromosome 5 |
Location: | 1419182 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g244200 | TMA1,COTH2 | spore coat protein H; (1 of 3) PF08757 - CotH protein (CotH) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCAGCGGCCGTGGAACGCACCCCGCCGTA |
Internal bar code: | TTCTGGTCTAATCCGAGGTCAT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 41 |
LEAP-Seq percent confirming: | 43.75 |
LEAP-Seq n confirming: | 49 |
LEAP-Seq n nonconfirming: | 63 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TGTCCTTGAGTAGCTGCCCT |
Suggested primer 2: | ACCCTCTTCCCAACCAGTTT |