| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077538 |
| Chromosome: | chromosome 6 |
| Location: | 2322797 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g267250 | MKP2 | (1 of 3) K04459 - dual specificity MAP kinase phosphatase (DUSP, MKP); Dual-specificity protein phosphatase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGTCGGCGAAAGGGTGCGGCCCCTGAAAAG |
| Internal bar code: | GCCAGCGCAACGCGTTCAGCGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 483 |
| LEAP-Seq percent confirming: | 93.457 |
| LEAP-Seq n confirming: | 957 |
| LEAP-Seq n nonconfirming: | 67 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGTTTGTACACGGGTGTTTG |
| Suggested primer 2: | CCATGAGGTAGGCAATGACC |