| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077543 |
| Chromosome: | chromosome 10 |
| Location: | 1864245 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g431450 | NAT24 | N-acetyltransferase; (1 of 1) 2.3.1.1//2.3.1.88 - Amino-acid N-acetyltransferase / N-acetylglutamate synthase // Peptide alpha-N-acetyltransferase / Protein N-terminal acetyltransferase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATCCGGCGTGCAGGATACGCGCTGCTTTTT |
| Internal bar code: | TAATTGCGTTGTTCGTCCGGCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 650 |
| LEAP-Seq percent confirming: | 98.917 |
| LEAP-Seq n confirming: | 274 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAACACACACACGCTCACAG |
| Suggested primer 2: | GGAATGAGCAAGGTGATGCT |