Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.077556 |
Chromosome: | chromosome 2 |
Location: | 384115 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g075900 | STK9,STPK9,SNRK2C | (1 of 1) IPR000719//IPR001245//IPR002290//IPR004223//IPR011009//IPR020635 - Protein kinase domain // Serine-threonine/tyrosine-protein kinase catalytic domain // Serine/threonine/dual specificity protein kinase, catalytic domain // Vitamin B12-dependent methionine synthase, activation domain // Protein kinase-like domain // Tyrosine-protein kinase, catalytic domain; snRK1 family in Chlamydomonas, subgroup 2 | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTGGCCAGTCACCCACCAGCGCGCCTCG |
Internal bar code: | CACCATTTTGCCCCGGACAGGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 191 |
LEAP-Seq percent confirming: | 91.7172 |
LEAP-Seq n confirming: | 454 |
LEAP-Seq n nonconfirming: | 41 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGTGACATATTGAATGGGGC |
Suggested primer 2: | GAAGCAAGGATCCAGAGTCG |