| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077572 |
| Chromosome: | chromosome 3 |
| Location: | 2361913 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g158550 | SRH4 | (1 of 1) K14437 - chromodomain-helicase-DNA-binding protein 7 [EC:3.6.4.12] (CHD7); SNF2-related DNA/RNA helicase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCACGCACACCCACCTTGTTCAGCTCCTC |
| Internal bar code: | CTCTGGGAGCCCTTGGGAGTCT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 164 |
| LEAP-Seq percent confirming: | 98.1333 |
| LEAP-Seq n confirming: | 736 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCCACCTCCATCATGTCTTT |
| Suggested primer 2: | GCCAACGACTCCTCAGACTC |