| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.077594 |
| Chromosome: | chromosome 5 |
| Location: | 2240831 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre05.g234661 | BCS1 | Ubiquinol-cytochrome c reductase complex chaperone; (1 of 1) K08900 - mitochondrial chaperone BCS1 (BCS1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCAAGAACGGCATCCGGTGCGTCCGTGTG |
| Internal bar code: | GGGGCTTTGGTTGTGACCGTGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 704 |
| LEAP-Seq percent confirming: | 96.053 |
| LEAP-Seq n confirming: | 10440 |
| LEAP-Seq n nonconfirming: | 429 |
| LEAP-Seq n unique pos: | 57 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CAAGCTGTGGAAGGAGAAGG |
| Suggested primer 2: | CACGCAAAGGTCTTCTCCTC |