Insertion junction: LMJ.RY0402.077608_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.077608
Chromosome:chromosome_16
Location:1437961
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g652400 FAL18 Similar to Flagellar Associated Protein FAP183 sense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):CGCACAGCTTCATGCTGGAGCAGCTGTCCA
Internal bar code:GTCCCCCCGGTTGACGGGCGA

Confirmation - LEAP-Seq

LEAP-Seq distance:118
LEAP-Seq percent confirming:99.2248
LEAP-Seq n confirming:512
LEAP-Seq n nonconfirming:4
LEAP-Seq n unique pos:6

Suggested primers for confirmation by PCR

Suggested primer 1:TACATGGACCAACACCTGGA
Suggested primer 2:AGACAGCAGCAGAAAGCACA