| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.077679 |
| Chromosome: | chromosome 10 |
| Location: | 4050310 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449250 | KAP1,FLA3 | Kinesin II Associated Protein 1; (1 of 1) PTHR15605:SF2 - KINESIN-ASSOCIATED PROTEIN 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGGATCCATGGTATGCCCCAGCCACGCCC |
| Internal bar code: | ATGCCACACTATTAGGGAACAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 653 |
| LEAP-Seq percent confirming: | 94.8718 |
| LEAP-Seq n confirming: | 37 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCATACACGTGGGAGGACTT |
| Suggested primer 2: | AGGCGTGTACAGGTAGTGGC |