Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.077802 |
Chromosome: | chromosome 12 |
Location: | 2812575 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g502600 | SLT1 | Sodium/sulfate co-transporter; (1 of 2) PF00939//PF02080 - Sodium:sulfate symporter transmembrane region (Na_sulph_symp) // TrkA-C domain (TrkA_C) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTACCCACCCGGATCCAGATTAAGATCG |
Internal bar code: | TGTGGCGTTCGGGTACTTGGGT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 113 |
LEAP-Seq percent confirming: | 94.1176 |
LEAP-Seq n confirming: | 144 |
LEAP-Seq n nonconfirming: | 9 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | TACCTTCCACGCTACCCAAC |
Suggested primer 2: | GTTTGATGACCACAACGCAC |