Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.077886 |
Chromosome: | chromosome 15 |
Location: | 733833 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre15.g640250 | (1 of 1) K07562 - nonsense-mediated mRNA decay protein 3 (NMD3) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGTCCAATACCTCCCCCACACACACCTGCA |
Internal bar code: | GCGCATCACTGAGAGAGGCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 493 |
LEAP-Seq percent confirming: | 97.9008 |
LEAP-Seq n confirming: | 27703 |
LEAP-Seq n nonconfirming: | 594 |
LEAP-Seq n unique pos: | 89 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CAAGGATTCTCCTCCTTCCC |
Suggested primer 2: | GTTTGGTATAGGGGGAGGGA |