| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.077933 |
| Chromosome: | chromosome 12 |
| Location: | 4828538 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g524700 | HAD4 | Haloacid dehalogenase-like hydrolase; (1 of 1) K18551 - pyrimidine and pyridine-specific 5'-nucleotidase (SDT1) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGAGCGCATCCAGGGTGAGCACCGCTCTTT |
| Internal bar code: | GTTGCAAACTCGTAACTGCCGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 642 |
| LEAP-Seq percent confirming: | 98.5113 |
| LEAP-Seq n confirming: | 4963 |
| LEAP-Seq n nonconfirming: | 75 |
| LEAP-Seq n unique pos: | 25 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACTGCTTCCCCGACTCAG |
| Suggested primer 2: | ACACGTTGCACCCCTCTTAC |