| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.077952 |
| Chromosome: | chromosome 12 |
| Location: | 5777437 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g533300 | SRE2 | Pre-mRNA splicing factor, SR-related; (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGAGCAGTGGGCCACATCGACACCATTCC |
| Internal bar code: | CGACTACTCTCAGGCCCGTTAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 107 |
| LEAP-Seq percent confirming: | 57.6592 |
| LEAP-Seq n confirming: | 1739 |
| LEAP-Seq n nonconfirming: | 1277 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGACCTACTCCAAGGTGCG |
| Suggested primer 2: | GTGTCCTACTCCCCACCTGA |