| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.077955 |
| Chromosome: | chromosome 7 |
| Location: | 3678990 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g337450 | GT90F9,GT90-9,CGL75 | Glycosyl transferase GT90 family protein 9; (1 of 52) PF05686 - Glycosyl transferase family 90 (Glyco_transf_90) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCAGCGCGGACTGCTGGCGCCCGCAGGGAA |
| Internal bar code: | CTGCTGGTGTGTACTGCGATAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 461 |
| LEAP-Seq percent confirming: | 98.9691 |
| LEAP-Seq n confirming: | 96 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGGCAGGTACTGGGGTC |
| Suggested primer 2: | AGACCGGTGACACTTGGTTC |