Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.078090 |
Chromosome: | chromosome 16 |
Location: | 6014858 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre16.g676400 | HEL63 | (1 of 1) K12811 - ATP-dependent RNA helicase DDX46/PRP5 (DDX46, PRP5); DEAD/DEAH box helicase | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCAAGACCCTAGCGCGCACCCGAGTCTAA |
Internal bar code: | CCGCGCTGGTTGGTACGCATGG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 143 |
LEAP-Seq percent confirming: | 96.4664 |
LEAP-Seq n confirming: | 273 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTACGGTATGTGCCCGAG |
Suggested primer 2: | CCTGTGTGTGTTTGTGGGAG |