Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.078154 |
Chromosome: | chromosome 12 |
Location: | 2960367 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre12.g501403 | MLO2 | (1 of 1) PF03094//PF13833 - Mlo family (Mlo) // EF-hand domain pair (EF-hand_8); MLO family protein | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCTCACGCTCCCGTTCCCACTTGTCCCAG |
Internal bar code: | ATGCATTCCTTTTTCCCGTCTC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 81 |
LEAP-Seq percent confirming: | 90.6542 |
LEAP-Seq n confirming: | 97 |
LEAP-Seq n nonconfirming: | 10 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGGTCTTTGGCCTTCCAGTT |
Suggested primer 2: | TAACATGCCTTGTCCTGCTG |