Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.078177 |
Chromosome: | chromosome 17 |
Location: | 3111728 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g721350 | GST13 | Glutathione S-transferase; (1 of 6) K00799 - glutathione S-transferase (GST, gst) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCTGCCTCTCCGCACAGCTAACCCCACTT |
Internal bar code: | AGCTGATGGGCTGCGGCTTAGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 198 |
LEAP-Seq percent confirming: | 41.0448 |
LEAP-Seq n confirming: | 1210 |
LEAP-Seq n nonconfirming: | 1738 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GACCTCGCCAGTTGTAGAGC |
Suggested primer 2: | TTCAATAGTTTCCGCAACCC |