| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.078404 |
| Chromosome: | chromosome 3 |
| Location: | 8314591 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g199050 | (1 of 1) IPR000595//IPR000719//IPR000961//IPR002290//IPR011009//IPR014710//IPR018490//IPR020635//IPR027916 - Cyclic nucleotide-binding domain // Protein kinase domain // AGC-kinase, C-terminal // Serine/threonine/dual specificity protein kinase, catalytic domain // Protein kinase-like domain // RmlC-like jelly roll fold // Cyclic nucleotide-binding-like // Tyrosine-protein kinase, catalytic domain // Protein kinase-like domain, Apicomplexa | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATATCCCCAAATACACACACGCACTCCCC |
| Internal bar code: | GGCGAAAGTGGAGGCTGTCCTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 142 |
| LEAP-Seq percent confirming: | 99.7457 |
| LEAP-Seq n confirming: | 8629 |
| LEAP-Seq n nonconfirming: | 22 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CACACACTGCAGGTTCTGCT |
| Suggested primer 2: | GCGTGATGGAGTGGGATAGT |