| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.078407 |
| Chromosome: | chromosome 11 |
| Location: | 1841256 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467850 | PGA6 | (1 of 2) K13511 - monolysocardiolipin acyltransferase (TAZ); Putative phospholipid/glycerol acyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GACGGCGTTGTTGCTTGTAGGCTTGTGCGG |
| Internal bar code: | CCCAGGGATACGCGAGGTGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 820 |
| LEAP-Seq percent confirming: | 92.9958 |
| LEAP-Seq n confirming: | 8577 |
| LEAP-Seq n nonconfirming: | 646 |
| LEAP-Seq n unique pos: | 45 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGACAACGAGCTATGCCCT |
| Suggested primer 2: | CTATTTAGCTGCTGGTCGCC |