Insertion junction: LMJ.RY0402.078448_1

Overview

Insertion cassette:CIB1
Side of cassette:5'
Strand:-
Strain:LMJ.RY0402.078448
Chromosome:chromosome_13
Location:1616885
Confidence (%):73
Locus disrupted Locus common name Defline Orientation Feature
Cre13.g573500 FAP95 Flagellar Associated Protein antisense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):TCACAAGTGGCGAGCGCGACAGGGCGGACA
Internal bar code:GGTCCTTTATGGGATTGAGGTT

Confirmation - LEAP-Seq

LEAP-Seq distance:1282
LEAP-Seq percent confirming:99.6317
LEAP-Seq n confirming:12443
LEAP-Seq n nonconfirming:46
LEAP-Seq n unique pos:11

Suggested primers for confirmation by PCR

Suggested primer 1:CACCACTCCGACGGTAACTT
Suggested primer 2:AGACACAGAGGGAGGCTCAA