Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.078451 |
Chromosome: | scaffold 18 |
Location: | 95552 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre18.g748697 | (1 of 2) PTHR31362//PTHR31362:SF0 - FAMILY NOT NAMED // PROTEIN E03H4.4-RELATED | 5'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GAAGAAACCCTGTATCTGTACAGTTGACCA |
Internal bar code: | ATGGCGTTGGGCATGATCAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 324 |
LEAP-Seq percent confirming: | 92.8665 |
LEAP-Seq n confirming: | 1419 |
LEAP-Seq n nonconfirming: | 109 |
LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CGTGGTCTCGCACTAAGTCA |
Suggested primer 2: | CACGATTGAAAACACGATGG |