Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.078528 |
Chromosome: | chromosome 11 |
Location: | 1769809 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre11.g467795 | (1 of 1) K05853 - Ca2+ transporting ATPase, sarcoplasmic/endoplasmic reticulum (ATP2A) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTAGAGGGGAGGGCGGTGGGGAGGGGGGAC |
Internal bar code: | GGACAGGAGTGCGCGCGTCGTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 191 |
LEAP-Seq percent confirming: | 91.2957 |
LEAP-Seq n confirming: | 1374 |
LEAP-Seq n nonconfirming: | 131 |
LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGGAATGGTCTGTAGGGGTT |
Suggested primer 2: | ACACACACACACACGCACAC |