| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.078567 |
| Chromosome: | chromosome 16 |
| Location: | 4316819 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g667750 | RPB7,RPB7A | (1 of 1) K03015 - DNA-directed RNA polymerase II subunit RPB7 (RPB7, POLR2G); DNA-directed RNA polymerase II, 19 kDa polypeptide | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAACCGAACCCAACGCATTAGAGCGAGGA |
| Internal bar code: | GGCTTCGTTAGTTTTGCTGGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 99.3109 |
| LEAP-Seq n confirming: | 2306 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCTTGTTGACGGAGGTGAC |
| Suggested primer 2: | AGGGTAGTCGGCGATAGGTT |