| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.078599 |
| Chromosome: | chromosome 2 |
| Location: | 1773364 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g086650 | SMC2,DIV35 | (1 of 1) K06674 - structural maintenance of chromosome 2 (SMC2); Structural Maintenance of Chromosomes protein | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGGGTAGGGGTGCGGCGGCGGTGTTACGCC |
| Internal bar code: | GTCTGCTCGGATGTTGGGTCGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 161 |
| LEAP-Seq percent confirming: | 96.732 |
| LEAP-Seq n confirming: | 148 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCAACTGCTCATTGCTCA |
| Suggested primer 2: | GCAGCTGAGTGTCTGAGTCG |